View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9951_high_14 (Length: 252)
Name: NF9951_high_14
Description: NF9951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9951_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 2e-48; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 125 - 234
Target Start/End: Original strand, 32319822 - 32319931
Alignment:
| Q |
125 |
gtggtttcgtcaaatgttaatttgtcttttctgcaaccgccttttgaacatgaaaaatttgtcttgcaattaggtggtgggagacaacacaacacctcga |
224 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32319822 |
gtggttttgtcaaatgttaatttgtcttttctgcaaccgccttttgaacacgaaaaatgtgtcttgcaattaggtggtgggagacaacacaacacctcga |
32319921 |
T |
|
| Q |
225 |
ctttgatacc |
234 |
Q |
| |
|
|||||||||| |
|
|
| T |
32319922 |
ctttgatacc |
32319931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 11 - 109
Target Start/End: Original strand, 32319739 - 32319837
Alignment:
| Q |
11 |
cagagaaagtaacacaaacggtaatattcccaatcctaacttatctgaaaccatatcgcacttggaggcattgtccctgtgatgtggtttcgtcaaatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
32319739 |
cagagaaagtaacacaaacggtaatattcccaatcctaacttatttgaaaccatatcacacttggaggcattgtccttgtgatgtggttttgtcaaatg |
32319837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 128 - 234
Target Start/End: Original strand, 32366705 - 32366811
Alignment:
| Q |
128 |
gtttcgtcaaatgttaatttgtcttttctgcaaccgccttttgaacatgaaaaatttgtcttgcaattaggtggtgggagacaacacaacacctcgactt |
227 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||||||||||| |||||||| ||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
32366705 |
gtttcatcaaatgttaagttgtcttttctgcaatggccttttgaacctgaaaaatgtgtcttgcaattaggtggtaggagacaacacaacacctcggctt |
32366804 |
T |
|
| Q |
228 |
tgatacc |
234 |
Q |
| |
|
||||||| |
|
|
| T |
32366805 |
tgatacc |
32366811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 49
Target Start/End: Original strand, 32366607 - 32366645
Alignment:
| Q |
11 |
cagagaaagtaacacaaacggtaatattcccaatcctaa |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32366607 |
cagagaaagtaacacaaacggtaatattccaaatcctaa |
32366645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University