View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9951_high_19 (Length: 230)

Name: NF9951_high_19
Description: NF9951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9951_high_19
NF9951_high_19
[»] chr7 (1 HSPs)
chr7 (1-209)||(22626734-22626943)


Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 22626943 - 22626734
Alignment:
1 aacacaaatccaatgaagatataatataaccaa-tatccaattcaatacaaacacgagcagaaacttgaaatatgcaaaaatagcttgcagggaaaacaa 99  Q
    |||| |||| ||||||||||||||||||||||| |||||||||| | | |||||||||||||||||||||| ||||||| || ||||||||||||| |||    
22626943 aacataaatgcaatgaagatataatataaccaaatatccaattcgacagaaacacgagcagaaacttgaaagatgcaaatatggcttgcagggaaatcaa 22626844  T
100 atgatactattcaaaattcaaaactaaataaaacaatagaattgaaataacaacttcaaaacagtaaacttagcaatattgtctctttgtccattgctaa 199  Q
    ||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||    
22626843 atgatactattaaaaattcaaaactaaataaaacaatagaatagaaataacaacttcaaaacagtaaacctagcattattgtctccttgtccattgctaa 22626744  T
200 ctttcctcca 209  Q
    ||||||||||    
22626743 ctttcctcca 22626734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University