View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9951_low_18 (Length: 320)
Name: NF9951_low_18
Description: NF9951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9951_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 14804173 - 14803869
Alignment:
| Q |
1 |
agtagaatgcaaagtaatcacgaaggttgtagacggaaagagaaaaatgaaattcggaatggaatggcaattgttttgtcgtttaaatggatttcaagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14804173 |
agtagaatgcaaagtaatcacgaaggttgtagacggaaagagaaaaatgaaattcggaatggaatggcaattgttttgtcgtttaaatggatttcaagag |
14804074 |
T |
 |
| Q |
101 |
ggtgatgagttgatgtttacctttgttaacatgttaagatcaaatgtcatcaaagtgaggaagatttaaatgtaatttcagtgtgttgaagatttcattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14804073 |
ggtgatgagttgatgtttacctttgttaacatgtcaagatcaaatgtcatcaaagtgaggaagatttaaatgtaatctcagtgtgttgaagatttcattt |
14803974 |
T |
 |
| Q |
201 |
ttcttattttcgtttatcttaatgtcatatgtc--nnnnnnnnnnnnnaatttatgtcatgaactttagtatt-aattgttcaatgtttttaaatatgaa |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
14803973 |
ttcttattttcgtttatcttaatgtcatatgtcttttttttttttttaaatttatgtcatgaactttagtattaaagtgttcaatgtttttaaatatgaa |
14803874 |
T |
 |
| Q |
298 |
ctttg |
302 |
Q |
| |
|
||||| |
|
|
| T |
14803873 |
ctttg |
14803869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University