View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9951_low_6 (Length: 454)
Name: NF9951_low_6
Description: NF9951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9951_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 404; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 404; E-Value: 0
Query Start/End: Original strand, 18 - 441
Target Start/End: Original strand, 48268312 - 48268735
Alignment:
| Q |
18 |
tttgtttccgattttggaggttgatgttaccggtggagagcagcttggggatttgcaggatacggggcagaagtattttgatgctgtgaatggtcttgtt |
117 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48268312 |
tttgtttccgttttcggaggttgatgttaccggtggagagcagcttggggatttgcaggatacggggcagaagtattttgatgctgtgaatggtcttgtt |
48268411 |
T |
|
| Q |
118 |
gatgggaatggggtggtttgtggcgggttcaagagtaaggagagtgttactagtgcggcttcaacacaaaattctgatttgagtgggatagattctattg |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48268412 |
gatgggaatggggtggtttgtggtgggttcaagagtaaggagagtgttactagtgcggcttcaacacaaaattctgatttgagtgggatagattctattg |
48268511 |
T |
|
| Q |
218 |
atagcccagttgtcggtcaaggggattcaacgccttatgttttatcgcctagagagaatgtggcgggttctccggacacaagtgcaggttttttggtttc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48268512 |
atagcccagttgtcggtcaaggggattcaacgccttatgttttatcgcctagagagaatgtggcgggttctccggacacaagtgcaggttttttggtttc |
48268611 |
T |
|
| Q |
318 |
tgagtcttgtacaccagtttactcaggtgcttcacctgtttcatttggcatgtctgtggctaatactggtccaaatcacaatccatatattcataatgag |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48268612 |
tgagtcttgtacaccagtttactcaggtgcttcgcctgtttcatttggcatgtctgtggctaagactggtccaaatcacaatccatatattcataatgag |
48268711 |
T |
|
| Q |
418 |
gttgaattagaaaagtctgtgcct |
441 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48268712 |
gttgaattagaaaagtctgtgcct |
48268735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University