View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9953_low_2 (Length: 257)
Name: NF9953_low_2
Description: NF9953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9953_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 242
Target Start/End: Complemental strand, 9462793 - 9462567
Alignment:
| Q |
16 |
gacatcaagaaagtaagttctactactaaatcatgcacttcctaaatgctatatatgtagttaaagattatttcccttgttaaggaagctatgcaacatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9462793 |
gacatcaagaaagtaagttctactactaaatcatgcacttcctaaatgctatatatgtagttaaagattatttcccttgttaaggaagctatgcaacatt |
9462694 |
T |
 |
| Q |
116 |
gacaccgaagacatatctattgtctgacacaacactcacacgtgtaattacattcattaacttccatttttacaatggtgtcaatgtcgtgtctgtgtca |
215 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9462693 |
gacaccgaagacatgtctattgtctgacacgacactcacacgtgtaattacgttcattaacttccatttttacaatggtgtcaatgtcgtgtctgtgtca |
9462594 |
T |
 |
| Q |
216 |
gtgtttcatagtttgatcagtgatgag |
242 |
Q |
| |
|
||||||||||||||||| ||||||||| |
|
|
| T |
9462593 |
gtgtttcatagtttgattagtgatgag |
9462567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 193 - 226
Target Start/End: Original strand, 10335771 - 10335804
Alignment:
| Q |
193 |
gtgtcaatgtcgtgtctgtgtcagtgtttcatag |
226 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
10335771 |
gtgtcactgtcgtgtctgtgtcagtgtttcatag |
10335804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 193 - 226
Target Start/End: Original strand, 33523453 - 33523486
Alignment:
| Q |
193 |
gtgtcaatgtcgtgtctgtgtcagtgtttcatag |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
33523453 |
gtgtcaatgtcgtgtctgtgtcagtgttttatag |
33523486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University