View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9954_high_33 (Length: 306)
Name: NF9954_high_33
Description: NF9954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9954_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 34275640 - 34275881
Alignment:
| Q |
1 |
gagaagaagaagaaagaaaatcgaggacacaactgatgtagcaacatatacaaaacaccatcctcttttctcatatcttggtaaaaaccnnnnnnnngca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34275640 |
gagaagaagaagaaagaaaatcgaggacacaactgatgtagcaacatatacaaaacaccatcctcttttctcatatcttggtaaaaaccttttttt-gca |
34275738 |
T |
 |
| Q |
101 |
ttcatttatctttatagcagcttatttgcatatcatttccttattgtttaccaatgcttgtccctactttagagaataagaaatctgatgctgatggctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34275739 |
ttcatttatctttatagcagcttatttgcatatcatttccttattgtttaccaatgcttgtccctactttagagaataagaaatctgatgctgatggctc |
34275838 |
T |
 |
| Q |
201 |
ttcggatgaagaatctgacaattcaggttagaaattatgttga |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34275839 |
ttcggatgaagaatctgacaattcaggttagaaattatgttga |
34275881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 231
Target Start/End: Original strand, 34283050 - 34283116
Alignment:
| Q |
165 |
tactttagagaataagaaatctgatgctgatggctcttcggatgaagaatctgacaattcaggttag |
231 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |||||| || | ||||||| | |||||| |
|
|
| T |
34283050 |
tactgtagagaataagaagtctgatgctgatggctctttggatgatgattttgacaatccgggttag |
34283116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 291
Target Start/End: Original strand, 34275882 - 34275914
Alignment:
| Q |
259 |
catttaactgcattatgttactggtttgtgtgt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34275882 |
catttaactgcattatgttactggtttgtgtgt |
34275914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University