View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9954_high_46 (Length: 209)
Name: NF9954_high_46
Description: NF9954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9954_high_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 190
Target Start/End: Original strand, 35353502 - 35353677
Alignment:
| Q |
15 |
agagaggggtcttagaatccaaggccaaaatggtgctgagattcattgggtatataacatctgtggaacctgtcatgatttgcttaacgatcattttgtt |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35353502 |
agagagggatcttagaatccaaggccaaaatggtgctgagattcattgggtatataacatctgtggaacctgtcatgatttgcttaacgatcattttgtt |
35353601 |
T |
 |
| Q |
115 |
ggctctttcagatggatgaaatgcatcccaaaataaatggtcgtcacggttttgacatatgcttgatgccaatgtg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35353602 |
ggctctttcagatggatgaaatgcatcccaaaataaatggtcgtcacggttttgacatatgcttgatgccaatgtg |
35353677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 148
Target Start/End: Original strand, 35357731 - 35357759
Alignment:
| Q |
120 |
tttcagatggatgaaatgcatcccaaaat |
148 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35357731 |
tttcagatggatgaaatgcatcccaaaat |
35357759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University