View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9954_low_41 (Length: 264)
Name: NF9954_low_41
Description: NF9954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9954_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 8877970 - 8877721
Alignment:
| Q |
1 |
tatagttcccctatcttttctcaatcataaatgagtataatgtgttgtatgggaatcaaaatattattgaaggtggctgaaaaaatttgtggaattagaa |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8877970 |
tatagttcctctatcttttctcaatcataaatgagtataatgtgcagtatgggaatcaaaatattattgaaggtggctgaaaaaatttgtggaattagaa |
8877871 |
T |
 |
| Q |
101 |
tggtccacattgtatttgattcttcctatggttggtaactcatgatcataattgaagtaattaccattatagtaggttgggtgggggcatagcctcaact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||| || |
|
|
| T |
8877870 |
tggtccacattgtatttgattcttcctatggttggtaactcatgatcataatttaagtaattaccattatagtaggtcgggtgggggcatagcatcatct |
8877771 |
T |
 |
| Q |
201 |
tttcattgtttttgttgaatggaggatcaaactattcttaatgttctcag |
250 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8877770 |
tttcgttgtttttgttgaatggaggatcaaactatttttaatgttctcag |
8877721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University