View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9954_low_50 (Length: 239)
Name: NF9954_low_50
Description: NF9954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9954_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 39243422 - 39243647
Alignment:
| Q |
1 |
gatatttgaaaaacttgtgtnnnnnnntatgatattgcacattttttcatcttgctttaatggcaagttttcctttctaaaatagaggttgcatatctcc |
100 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39243422 |
gatatttgaaaaacttatgtaaaaaaatatgatattgcacattttttcatcttgctttaatggcaagttttcctttctaaaatagag-ttgcatatctcc |
39243520 |
T |
|
| Q |
101 |
atgacactgttcccaattattttatagacaaaggttagcaattattattagaatttaa---cttctactcttataagattagattagatcagctatggta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39243521 |
atgacactgttcccaattattttatagacaaaggttagcaattattattagaatttaacttcttctactcttataagattagattagatcagctatggta |
39243620 |
T |
|
| Q |
198 |
cccaaatgaatcccaacctcagtatgt |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
39243621 |
cccaaatgaatcccaacctcagtatgt |
39243647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University