View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9954_low_54 (Length: 224)
Name: NF9954_low_54
Description: NF9954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9954_low_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 11 - 205
Target Start/End: Original strand, 31714935 - 31715130
Alignment:
| Q |
11 |
gagtttggtgttagaaattagtatcaaacatgtgcatctttaccaattaaatt-tatgagtattagttccagtgattgagttaaacacctaaaacagatt |
109 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31714935 |
gagttaggtgttagaaactagtatcaaacatgtgcatctttaccaattaaattatatgagtattagttccagtgattgagttaaacacctaaaacagatt |
31715034 |
T |
|
| Q |
110 |
gaaaaagtggtttggacttcaaattgttgctactcataaaacatatttacaactaacgtttacaaacagaaaaactatttgagtattagatagatg |
205 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31715035 |
gaaaaagtggtttggaattcaaattgttgctactcatgaaacatatttacaactaacgtttacatacagaaaaactatttgagtattagatagatg |
31715130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University