View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9954_low_55 (Length: 223)
Name: NF9954_low_55
Description: NF9954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9954_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 23 - 206
Target Start/End: Original strand, 35730437 - 35730620
Alignment:
| Q |
23 |
cccgtcacccgttggtcacccgatcaaaacctcttccccggtatgtcaacctccgatcacattcaacaacgatcacaacctcgttcacgttccgattgct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35730437 |
cccgtcacccgttggtcacccgatcaaaacctcttccccggtatgtcaacctccgatcacattcaacaacgatcacaacctcgttcacgttccgattgct |
35730536 |
T |
 |
| Q |
123 |
caagtctcttcggcaattctcattccccttcttttccttactttcgtgattggactcttgatttctcctccgatctctccccta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35730537 |
caagtctcttcggcaattctcattccccttcttttccttactttcgtgattggactcttgatttctcctccgatctctccccta |
35730620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University