View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9955_high_5 (Length: 391)
Name: NF9955_high_5
Description: NF9955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9955_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 194 - 382
Target Start/End: Original strand, 35116771 - 35116959
Alignment:
| Q |
194 |
atccgtcccccaaccaaatggtgcaattccgaatcaattctagactcatcgccatcggatccaaaactttgtcttgagggcgactgatcagaactctgca |
293 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35116771 |
atccgtcccccaaccaaatggtgcaactccgaatcaattctagactcatcgccatcggatccaaaactttgtcttgagggcgactgatcagaactctgca |
35116870 |
T |
|
| Q |
294 |
tatcacacacattttcataaagctgctcgattgaaggctcaacaaccccatcatcctggaaattaggaccgacactttgacgtctctgc |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35116871 |
tatcacacacattttcataaagctgctcgattgaaggctcaacaaccccatcatcctggaaattaggaccgacactttgacgtctctgc |
35116959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 19 - 130
Target Start/End: Original strand, 35116596 - 35116707
Alignment:
| Q |
19 |
agattgaatctcaatcaccggactgttactaccagattgaatctcagccaccatatccaacttcttatcatcagataaattacccattccagaagatgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35116596 |
agattgaatctcaatcaccggacttttactaccagattgaatctcagccaccatatccatcttcttatcatcagataaattacccattccagaagatgtt |
35116695 |
T |
|
| Q |
119 |
tccccactagaa |
130 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35116696 |
tccccactagaa |
35116707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University