View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9955_low_4 (Length: 416)
Name: NF9955_low_4
Description: NF9955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9955_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 42 - 398
Target Start/End: Complemental strand, 55931874 - 55931513
Alignment:
| Q |
42 |
agaatggcatatggtgtgtatgctatgattcataagcagggttacctatacttgtaaagggtagtatagtactaataa-------atacttgctatatat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
55931874 |
agaatggcatatggtgtgtatgctatgattcataagcagggttacctatacttgtaaagggtagtatagtactaataattaataaatacttgctatgta- |
55931776 |
T |
|
| Q |
135 |
aggtctttgtcccatcatcactaataagattcttattatggtaatcgattttctttgttcattatttcatcttttcatatgacttctttcctaatttgaa |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55931775 |
-ggtctttgtcccatcatcactaataagattcttattatggtaatcgattttctttgttcattatttcatcttttcatatgacttctttcctaatttgaa |
55931677 |
T |
|
| Q |
235 |
gtgtttcaagaagcctttcaagttacagggtcatcaatattccaaatttgattgttctttatttggttcatctaatcatggttttgttggttctgtatgt |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55931676 |
gtgtttcaagaagcctttcaagttacagggtcatcaatattccaaatttgattgttctttatttggttcatctaatcatggttttgttggttctatatgt |
55931577 |
T |
|
| Q |
335 |
attgaggtctacctttgaactcagttattggttcgataagttctgtattgattggttctgccaa |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55931576 |
attgaggtctacctttgaactcagttattggttcgataagttctgtattgattggttctgccaa |
55931513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University