View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9956_high_10 (Length: 242)
Name: NF9956_high_10
Description: NF9956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9956_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 35 - 223
Target Start/End: Complemental strand, 51527319 - 51527131
Alignment:
| Q |
35 |
agtataatatatgccctagcttacacatacaataaggatacccaataaaaatgatggctatgatatgccaccatgccgtccacgcctaattaataaacaa |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51527319 |
agtataatatataccctagcttacacatacaataaggatacccaataaaaatgatgactatgatttgccaccatgccgtccacgcctaattaataaacaa |
51527220 |
T |
 |
| Q |
135 |
tctccttcaacagattaaattttgccaaatgctcaatctcatcaatgttattaagatcaaatctctctaatacatgaatatgtcgatcg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51527219 |
tctccttcaacagattaaattttgccaaatgctcaatctcatcaatgttattaagatcaaatctctctagtacatgaatatgtcgatcg |
51527131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University