View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9956_high_6 (Length: 284)
Name: NF9956_high_6
Description: NF9956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9956_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 11 - 281
Target Start/End: Complemental strand, 51527881 - 51527610
Alignment:
| Q |
11 |
gaagcaaaggtgtataggctagca-tatttataccagagttgataggacatttaatttttctaatgtttcgatctcattttggaagtagtttgtgaacac |
109 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51527881 |
gaagcaaaggggtataggctagcagtatttataccagagttgataggacatttaatttttctaatgtttcgatctcattttggaagtagtttgtgaacac |
51527782 |
T |
|
| Q |
110 |
actcaccatattaatcaaggaataagatcatcgtttctgtgctaatgtcagggttcagaaaatgttggagggaaattgaattgatgtgattgatctaata |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
51527781 |
actcaccatattaatcaaggaataagatcatcgttgctgtggtaatgttagggttcagaaaatgttggagggaaattgaattgatgtgagtgatataata |
51527682 |
T |
|
| Q |
210 |
agaagaaaacgggtcggagtagattgtgatcagaatattatgggctttttaaatcactacaccgtcttttcc |
281 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51527681 |
agaagaaaacggatcggagtagattgtgatcagaatattatgggctttttaaatcactacaccgtcttttcc |
51527610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University