View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9957_low_5 (Length: 203)
Name: NF9957_low_5
Description: NF9957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9957_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 17 - 142
Target Start/End: Complemental strand, 3245801 - 3245676
Alignment:
| Q |
17 |
attaatgaccacatcttattgttgtatatgtcattgttggatttaagaattgaatgatagagannnnnnnncaaagttttgtattgattcattatttgaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
3245801 |
attaatgaccacatcttattgttgtatatgtcattgttggatttaagaattgaatgataaagattttttttcaaagttttgtattgattcattatttgaa |
3245702 |
T |
 |
| Q |
117 |
attttgaaggcagtggtcttcctatc |
142 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
3245701 |
attttgaaggcagtggtcttcctatc |
3245676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University