View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9959_high_22 (Length: 283)
Name: NF9959_high_22
Description: NF9959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9959_high_22 |
 |  |
|
| [»] scaffold0209 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 5e-22; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 193 - 266
Target Start/End: Original strand, 10868664 - 10868737
Alignment:
| Q |
193 |
tggacactttcttactgttaagtttcaattttcaatggtcacattacatggtgccatgaaagagcagtgatgta |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||| || ||||| |
|
|
| T |
10868664 |
tggacactttcttactgttaagtttcaattttctatgctcacattacatggtgccgtgaaagagcggtaatgta |
10868737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 193 - 266
Target Start/End: Complemental strand, 10885721 - 10885648
Alignment:
| Q |
193 |
tggacactttcttactgttaagtttcaattttcaatggtcacattacatggtgccatgaaagagcagtgatgta |
266 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| || ||||||||||||||||||| |||||| ||||| |
|
|
| T |
10885721 |
tggacactttcttactcttaagtttcaattttgtatgctcgaattacatggtgccatgaaaaagcagtaatgta |
10885648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 198 - 239
Target Start/End: Original strand, 31607214 - 31607255
Alignment:
| Q |
198 |
actttcttactgttaagtttcaattttcaatggtcacattac |
239 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31607214 |
actttcttactgttaagtttcaattttctatggtcacattac |
31607255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 82 - 153
Target Start/End: Original strand, 10868405 - 10868475
Alignment:
| Q |
82 |
cattggtgaattatgttttgtggtgcactttttgtgtggaagatgcaattgtctcttttgtatggtgaattc |
153 |
Q |
| |
|
|||||||||||| |||||||||| | ||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
10868405 |
cattggtgaattctgttttgtgg-gagctttttgtgcggaagatgtgatagtctcttttgtatggtgaattc |
10868475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 153
Target Start/End: Complemental strand, 10885960 - 10885892
Alignment:
| Q |
85 |
tggtgaattatgttttgtggtgcactttttgtgtggaagatgcaattgtctcttttgtatggtgaattc |
153 |
Q |
| |
|
||||||||| |||||| |||| |||||||||||||||| | || |||||||||||||||||||||| |
|
|
| T |
10885960 |
tggtgaattcagttttgcggtgagctttttgtgtggaagacgtgatagtctcttttgtatggtgaattc |
10885892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0209 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0209
Description:
Target: scaffold0209; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 5927 - 5976
Alignment:
| Q |
111 |
ttttgtgtggaagatgcaattgtctcttttgtatggtgaattcagtttag |
160 |
Q |
| |
|
||||||| |||||||||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
5927 |
ttttgtggggaagatgcaatagtctcttttgtgtggtgaattcaatttag |
5976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0209; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 19381 - 19430
Alignment:
| Q |
111 |
ttttgtgtggaagatgcaattgtctcttttgtatggtgaattcagtttag |
160 |
Q |
| |
|
||||||| |||||||||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
19381 |
ttttgtggggaagatgcaatagtctcttttgtgtggtgaattcaatttag |
19430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University