View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9959_high_22 (Length: 283)

Name: NF9959_high_22
Description: NF9959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9959_high_22
NF9959_high_22
[»] chr5 (5 HSPs)
chr5 (193-266)||(10868664-10868737)
chr5 (193-266)||(10885648-10885721)
chr5 (198-239)||(31607214-31607255)
chr5 (82-153)||(10868405-10868475)
chr5 (85-153)||(10885892-10885960)
[»] scaffold0209 (2 HSPs)
scaffold0209 (111-160)||(5927-5976)
scaffold0209 (111-160)||(19381-19430)


Alignment Details
Target: chr5 (Bit Score: 54; Significance: 5e-22; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 193 - 266
Target Start/End: Original strand, 10868664 - 10868737
Alignment:
Q  193 tggacactttcttactgttaagtttcaattttcaatggtcacattacatggtgccatgaaagagcagtgatgta 266  Q
    ||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||||| || |||||    
T  10868664 tggacactttcttactgttaagtttcaattttctatgctcacattacatggtgccgtgaaagagcggtaatgta 10868737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 193 - 266
Target Start/End: Complemental strand, 10885721 - 10885648
Alignment:
Q  193 tggacactttcttactgttaagtttcaattttcaatggtcacattacatggtgccatgaaagagcagtgatgta 266  Q
    |||||||||||||||| |||||||||||||||  ||| ||  ||||||||||||||||||| |||||| |||||    
T  10885721 tggacactttcttactcttaagtttcaattttgtatgctcgaattacatggtgccatgaaaaagcagtaatgta 10885648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 198 - 239
Target Start/End: Original strand, 31607214 - 31607255
Alignment:
Q  198 actttcttactgttaagtttcaattttcaatggtcacattac 239  Q
    |||||||||||||||||||||||||||| |||||||||||||    
T  31607214 actttcttactgttaagtttcaattttctatggtcacattac 31607255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 82 - 153
Target Start/End: Original strand, 10868405 - 10868475
Alignment:
Q  82 cattggtgaattatgttttgtggtgcactttttgtgtggaagatgcaattgtctcttttgtatggtgaattc 153  Q
    |||||||||||| |||||||||| |  ||||||||| ||||||||  || ||||||||||||||||||||||    
T  10868405 cattggtgaattctgttttgtgg-gagctttttgtgcggaagatgtgatagtctcttttgtatggtgaattc 10868475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 85 - 153
Target Start/End: Complemental strand, 10885960 - 10885892
Alignment:
Q  85 tggtgaattatgttttgtggtgcactttttgtgtggaagatgcaattgtctcttttgtatggtgaattc 153  Q
    |||||||||  |||||| ||||  |||||||||||||||| |  || ||||||||||||||||||||||    
T  10885960 tggtgaattcagttttgcggtgagctttttgtgtggaagacgtgatagtctcttttgtatggtgaattc 10885892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0209 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0209
Description:

Target: scaffold0209; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 5927 - 5976
Alignment:
Q  111 ttttgtgtggaagatgcaattgtctcttttgtatggtgaattcagtttag 160  Q
    ||||||| |||||||||||| ||||||||||| ||||||||||| |||||    
T  5927 ttttgtggggaagatgcaatagtctcttttgtgtggtgaattcaatttag 5976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0209; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 19381 - 19430
Alignment:
Q  111 ttttgtgtggaagatgcaattgtctcttttgtatggtgaattcagtttag 160  Q
    ||||||| |||||||||||| ||||||||||| ||||||||||| |||||    
T  19381 ttttgtggggaagatgcaatagtctcttttgtgtggtgaattcaatttag 19430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University