View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9959_high_27 (Length: 249)
Name: NF9959_high_27
Description: NF9959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9959_high_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 14 - 249
Target Start/End: Complemental strand, 24058770 - 24058533
Alignment:
| Q |
14 |
agaccaaatctatcagaactttacgaacaattgatggttagatgtctcataatatggnnnnnnnncaatccagttgatttacaagatcattcccttccac |
113 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24058770 |
agaccaaatttatcagaactttacgaacaattgatggttagatgtctcagaatatggtatttttacaatccaattgatttacaagatcattcccttccac |
24058671 |
T |
 |
| Q |
114 |
cattgtagcttgcatcgtttgatat-atatggaactccaccacgtccctcacgttgcttatgttgccattataagagttggtaagacat-tttactatgg |
211 |
Q |
| |
|
|||||||||||||||| ||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24058670 |
cattgtagcttgcatcatttaatttgatatggaactccaccacgtccctcacgttgcttatgttgccattataagagttggtaagacatgtttactatgg |
24058571 |
T |
 |
| Q |
212 |
gaaaattacactaatcactgctcaccgtttatgtgaat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24058570 |
gaaaattacactaatcactgctcaccgtttatgtgaat |
24058533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University