View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9959_high_34 (Length: 227)
Name: NF9959_high_34
Description: NF9959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9959_high_34 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 44347944 - 44348170
Alignment:
| Q |
1 |
gttggcgtgcttgtcaagccacgtgatgatgtcttcaaaaactttttcaatgttgtcatcaggctcaccagatgttaaaccatgccacattccagggtac |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44347944 |
gttggcgtgcttgtcaagccatgtgatgatgtcttcaaaaactttttcaatgttgtcatcaggctcaccagatgttaaaccatgccacattccagggtac |
44348043 |
T |
 |
| Q |
101 |
aatttaattgtcttatctttgctactagctctctcatataatgccctgcttacttctgggtctgtcactgtatctgtttctccatgcaatacaaaaaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44348044 |
aatttaattgtcttatctttgctactagctctctcatataatgccctgcttacttctgggtctgtcactgtatctgtttctccatgcaatacaaaaaatg |
44348143 |
T |
 |
| Q |
201 |
gaaaggttacctgctcaaaattcaccc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44348144 |
gaaaggttacctgctcaaaattcaccc |
44348170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 56 - 225
Target Start/End: Complemental strand, 39562662 - 39562493
Alignment:
| Q |
56 |
tcatcaggctcaccagatgttaaaccatgccacattccagggtacaatttaattgtcttatctttgctactagctctctcatataatgccctgcttactt |
155 |
Q |
| |
|
||||||||||| |||| |||||| |||||||||||||||||||||||||| || ||||| ||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
39562662 |
tcatcaggctccccagctgttaagccatgccacattccagggtacaattttatggtcttgtctacactactagctctctcatataatgccttgcttactt |
39562563 |
T |
 |
| Q |
156 |
ctgggtctgtcactgtatctgtttctccatgcaatacaaaaaatggaaaggttacctgctcaaaattcac |
225 |
Q |
| |
|
| |||||||||||| ||||| |||||||| || || || || || || || ||||||||||||||||| |
|
|
| T |
39562562 |
ccgggtctgtcactttatcttcctctccatgtaacactaagaaaggcaacgtcacctgctcaaaattcac |
39562493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 76 - 123
Target Start/End: Original strand, 52216331 - 52216378
Alignment:
| Q |
76 |
taaaccatgccacattccagggtacaatttaattgtcttatctttgct |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
52216331 |
taaaccatgccacattccagggtacaatttcagtgtcttatctttgct |
52216378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University