View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9959_low_29 (Length: 319)
Name: NF9959_low_29
Description: NF9959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9959_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 308
Target Start/End: Original strand, 2354568 - 2354872
Alignment:
| Q |
17 |
agttttttcttacaaacttgatgtgatcggaacttttaggagcctaaagaagaaatacgtttcatccttcaaatgaatccc--------------ggtga |
102 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
2354568 |
agttttttcgtactaacttgatgtgatcggaacttttaggagcctaaagaagaaatacgtttcatctttcaaatgaatccctaactatattagtcggtga |
2354667 |
T |
 |
| Q |
103 |
gggatggactatgtcacgactcacgatatttcaaaaacaaaattcgacatcaacattgcatgtatatgtgatctacgattttaatattttttctctcatt |
202 |
Q |
| |
|
|| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2354668 |
gg-atggactatgtcacaactcacgatatttcaaaaacaaaattcgacatcaacattgcatgtatatgtgatctacgattttcatattttttctctcatt |
2354766 |
T |
 |
| Q |
203 |
cagcaatttttacaccacacattctaattatattttatacaatgtcaaatatgatatttgacttatgtacttatatatggttttcgattttaatcatgtt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2354767 |
cagcaatttttacaccacacattctaattatattttatacaatgtcaaatatgatatttgacttatgtacttatatattgttttcgattttaatcatgtt |
2354866 |
T |
 |
| Q |
303 |
ctctct |
308 |
Q |
| |
|
|||||| |
|
|
| T |
2354867 |
ctctct |
2354872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University