View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9959_low_32 (Length: 302)
Name: NF9959_low_32
Description: NF9959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9959_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 9 - 258
Target Start/End: Complemental strand, 45889308 - 45889054
Alignment:
| Q |
9 |
tggtgttactgcgagattataaaaattatggtggctttgatttagtagaagttataaaatgtaacttttgtttttgttaaaattacggatttattatgat |
108 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45889308 |
tggtgttactgcgagattatataaattatggtggctttgatttagtagatgttataaaatgtaacttttgtttttgttaaaattacggatttattatgat |
45889209 |
T |
|
| Q |
109 |
tttgagtttacactataagactctaaagtcttgttaaataattgtc-----tagattataatccgtgatccatcgtgatttcatttaataaactaagttc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45889208 |
tttgagtttacactataagactctaaagtcttgttaaataattgtcaagattagataataatccgtgatccatcgtgatttcatttaataaactaagttc |
45889109 |
T |
|
| Q |
204 |
acctcaaagagggattaacatggagaactggtatattaacaaacgtaattaggta |
258 |
Q |
| |
|
|||| ||||||||||||||||||||| || |||||||||||| ||| ||||||| |
|
|
| T |
45889108 |
accttaaagagggattaacatggagacctagtatattaacaattgtatttaggta |
45889054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University