View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9959_low_34 (Length: 298)
Name: NF9959_low_34
Description: NF9959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9959_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 38442579 - 38442298
Alignment:
| Q |
1 |
aatggaaggaagcgagaggatggtggccacgataaacattttttgcacatccagcaagtcacatcagccaagcgatttggtcttagttttaagggagaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
38442579 |
aatggaaggaagcgagaggatggtggccacgataaacattttttgcacattcagcaagtcatatcagccaaacgatttggtcttaattttaagggagaat |
38442480 |
T |
 |
| Q |
101 |
ataaagaaaagaagttaccaagatgtatcctcaaatttagccaaatggtaggggtgaaaccccgttaaccttaagaaatttaagagcattttaacttctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38442479 |
ataaagaaaagaagttaccaagatgtatcctcaaatttagccaaatggtaggggtgaaaccctcttaaccttaagaaatttaagagcattttaacttctt |
38442380 |
T |
 |
| Q |
201 |
attttctagcttgtttgaagaagttgaatatttatcacttagcatttgcaaatgatattatactcttccttgaacctttatt |
282 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38442379 |
attttctagcttgtttgaagaggttgaatatttatcacttagcatttgcaaatgatattatacttttccttgaacctttatt |
38442298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University