View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9959_low_38 (Length: 255)
Name: NF9959_low_38
Description: NF9959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9959_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 19 - 185
Target Start/End: Original strand, 50466406 - 50466572
Alignment:
| Q |
19 |
aaattgtcaatgtatgtttgattctattttttgagaattaattannnnnnnnaagaagtttagagagagaaagaatcaaaattgattttaaataagtaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
50466406 |
aaattgtcaatgtatgtttgattctatttttagagaattaattattatttttaagaagtttagagagagagagaattaaaattgattttaaataagtaaa |
50466505 |
T |
 |
| Q |
119 |
attatgaacacttagaattaaattattgtcaccgtaacattttatattcgaagatcaattttgtttt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50466506 |
attatgaacacttagaattaaattattgtcaccgtaacattttatattcgaagatcaattttgtttt |
50466572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 184 - 244
Target Start/End: Original strand, 50466607 - 50466667
Alignment:
| Q |
184 |
ttataatttgctggcattgtagcaaccaccttttgatcaatccgatggtatctataaacca |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50466607 |
ttataatttgctggcattgtagcaaccaccttttgatcaatccgatggtatctataaacca |
50466667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University