View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9959_low_39 (Length: 250)
Name: NF9959_low_39
Description: NF9959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9959_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 36638653 - 36638890
Alignment:
| Q |
1 |
taactggtgtttggaaataagaaagaaaggttacactgtcatatgatagttctatcccaatccaattctggttttttgatgcagtgaatgcaacggactt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36638653 |
taactagtgtttggaaataagaaagaaaggttacgctgtcatatgatagttctatcccaatccaattctggttttttgatgcagtgaatgcaacggactt |
36638752 |
T |
|
| Q |
101 |
gccattcttgaatgcctatatggattcctttggcttgccaaatttccatcaaggatgcaactttgcagcatcaggttcaactatccttccagcctgcagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36638753 |
gccattcttgaatgcctatatggatttctttggcttgccaaatttccatcaaggatgcaactttgcagcatcaggttcaactatccttccagcctgaagc |
36638852 |
T |
|
| Q |
201 |
gcggttcagtccgttcagctttggggttcaagtatctc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36638853 |
acggttcagtccgttcagctttggggttcaagtatctc |
36638890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 80 - 193
Target Start/End: Original strand, 36633971 - 36634084
Alignment:
| Q |
80 |
tgcagtgaatgcaacggacttgccattcttgaatgcctatatggattcctttggcttgccaaatttccatcaaggatgcaactttgcagcatcaggttca |
179 |
Q |
| |
|
||||||| |||||| ||||||||||||||| ||||||||| ||||||| | |||| ||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
36633971 |
tgcagtggatgcaatggacttgccattcttaaatgcctatctggattcagtgggctcgccaaatttccatcacggatgcaactttgcagcagcaggttca |
36634070 |
T |
|
| Q |
180 |
actatccttccagc |
193 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36634071 |
actatccttccagc |
36634084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 194
Target Start/End: Complemental strand, 46938119 - 46938027
Alignment:
| Q |
102 |
ccattcttgaatgcctatatggattcctttggcttgccaaatttccatcaaggatgcaactttgcagcatcaggttcaactatccttccagcc |
194 |
Q |
| |
|
|||||||| ||||| ||| ||||||| || || ||||||||||| |||| || ||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
46938119 |
ccattcttaaatgcatatttggattcattgggtttgccaaattttaggaaaggttgtaacttcgcagcagctggttcaactatccttccagcc |
46938027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University