View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9959_low_47 (Length: 236)

Name: NF9959_low_47
Description: NF9959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9959_low_47
NF9959_low_47
[»] chr2 (1 HSPs)
chr2 (1-220)||(3359329-3359548)
[»] chr1 (1 HSPs)
chr1 (59-110)||(22066642-22066693)


Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 3359548 - 3359329
Alignment:
1 actacggatcaaccaagagacagcggacactgaaaagtcgtcctgctggtacgatcgtaattgatgataatgctattgttctttatgaaggtggcataac 100  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3359548 actacggatcaaccaagaggcagcggacactgaaaagtcgtcctgctggtacgatcgtaattgatgataatgctattgttctttatgaaggtggcataac 3359449  T
101 aaattcagatagggttccgacggataatgcaagccaatataatggcaaggagctttcgttggtggattaccatagtgagagatcacaaaccttaatgaaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
3359448 aaattcagatagggttccgacggataatgcaagccaatataatggcaaggagctttcgttggtggattaccataatgagagatcacaaaccttaatgaaa 3359349  T
201 gagacattggtcgtgttgaa 220  Q
    ||||||||||||||||||||    
3359348 gagacattggtcgtgttgaa 3359329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 59 - 110
Target Start/End: Complemental strand, 22066693 - 22066642
Alignment:
59 aattgatgataatgctattgttctttatgaaggtggcataacaaattcagat 110  Q
    |||||||| ||||||||||||| ||||||| |||| ||||||||||||||||    
22066693 aattgatgctaatgctattgttgtttatgagggtgacataacaaattcagat 22066642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University