View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9959_low_49 (Length: 233)
Name: NF9959_low_49
Description: NF9959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9959_low_49 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 31056267 - 31056034
Alignment:
| Q |
1 |
gtgtaatactaaggaatttgatgtcaagataaaatcatataa-tataacctttaaggcgtaaccaaccatgcatcaactcgtgtgcaaggatagcacctg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31056267 |
gtgtaatactaaggaatttgatgtcaagataaaatcatataaatataacctttaaggcgtaaccaaccatgcatcaactcgtgtgcaaggatagcacctg |
31056168 |
T |
 |
| Q |
100 |
tgagtaacctgcacccataaatatatcagaacacttgttataaagccttaacatattcacaaacataaagtagaatgtaaattttacacctgaaaattgt |
199 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31056167 |
tgagtaacctgcacccataaatatattagaacacttgttataaagccttaacatattcacaaacataaagtagaatgtaaattttacacctgaaaattgt |
31056068 |
T |
 |
| Q |
200 |
ggtttacgttcaaaactgtggttaattgcgttga |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
31056067 |
ggtttacgttcaaaactgtggttaattgccttga |
31056034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 128
Target Start/End: Original strand, 34742473 - 34742560
Alignment:
| Q |
42 |
atataacctttaaggcgtaaccaaccatgcatcaactcgtgtgcaaggatagcacctgtgagtaacctgca-cccataaatatatcag |
128 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| || || || |||||||| || ||||||||||| ||||||| ||||||| |
|
|
| T |
34742473 |
atattacctttaaggcgtaaccatgcatgcatcaactcatgggctagtatagcacccgttagtaacctgcatgccataaaaatatcag |
34742560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University