View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9959_low_50 (Length: 229)
Name: NF9959_low_50
Description: NF9959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9959_low_50 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 46102312 - 46102090
Alignment:
| Q |
7 |
ctttggtttcttggtttagtagttgttgaggcatgcttgttatgcattctattgccattgcattaattagttaataatacaaaaattgtagctatgatca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46102312 |
ctttggtttcttggtttagtagttgttgaggcatgcttgttatgcattctattgccattgcattaattagttaataatacaaaaattgtagctatgatca |
46102213 |
T |
|
| Q |
107 |
nnnnnnnnnnnnnnnnnaagagtagttgttatcacgaggagagggaatgaaaataagttgatagatgagatgaaagaaacgccaaggccgtttgtttagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46102212 |
agagagagagagagagaaagagtagttgttatcacgaggagagggaatgaaaataagttgatagatgagatgaaagaaacgccaaggccgtttgtttggg |
46102113 |
T |
|
| Q |
207 |
aaatcttggaacaaactttggaa |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46102112 |
aaatcttggaacaaactttggaa |
46102090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University