View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_1D_high_16 (Length: 282)
Name: NF9960_1D_high_16
Description: NF9960_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_1D_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 20 - 145
Target Start/End: Original strand, 28591630 - 28591750
Alignment:
| Q |
20 |
attgaagtgttgcgttcaacttattggatgatacccatcacccaacacctttctctccttaaataatcatctacctctctcttaatcttacattgggatt |
119 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28591630 |
attgaagggttgcgttcaatttattggatgatacccatcacccaacacctttctctccttaaataatcatctacctctctcttaatc-----ttgggatt |
28591724 |
T |
|
| Q |
120 |
tgatgactttaagcgaaaaggttaca |
145 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
28591725 |
tgatgactttaagcgaaaaagttaca |
28591750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 217 - 267
Target Start/End: Original strand, 28591821 - 28591871
Alignment:
| Q |
217 |
actaaaataaaagtgactttctcgcattaaagttactcgatctcaattcct |
267 |
Q |
| |
|
|||||||| ||||| ||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
28591821 |
actaaaatcaaagtaactttctcgtattaaagttactcaatctcaattcct |
28591871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University