View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_1D_high_17 (Length: 258)
Name: NF9960_1D_high_17
Description: NF9960_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_1D_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 22 - 249
Target Start/End: Original strand, 1374571 - 1374798
Alignment:
| Q |
22 |
atgaggttattaggcaaacttttactattgcattccaaaaagtctcaaagccattcgtggtctgaaaatcatcttcagacgctaaatatcaggcctctta |
121 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1374571 |
atgaggttattaggcaaacttttaccattgcattccaaaaagtctcaaagccattcgtggtctgaaaatcatcttcagacgctaaatatcaggcctctta |
1374670 |
T |
|
| Q |
122 |
ccttctactgtttgcaatggcttacataccttcagtatgattcccatttacttttcattttccaatctttattataccgttgatggccggtctgctcact |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1374671 |
ccttctactgtttgcaatggcttacataccttcagtatgattcccatttacttttcattttccaatctttattataccgttgatggccggtctgctcact |
1374770 |
T |
|
| Q |
222 |
acatcgcatccaattcttccctctatga |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1374771 |
acatcgcatccaattcttccctctatga |
1374798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University