View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_1D_high_6 (Length: 481)
Name: NF9960_1D_high_6
Description: NF9960_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_1D_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 288; Significance: 1e-161; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 3 - 290
Target Start/End: Complemental strand, 31536489 - 31536202
Alignment:
| Q |
3 |
aataaatatgacgcagcaataaaccaaccatccaattacaccatgcagataagaagcaagatagaccactcccttcttgatcactaaaacacatatataa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536489 |
aataaatatgacgcagcaataaaccaaccatccaattacaccatgcagataagaagcaagatagaccactcccttcttgatcactaaaacacatatataa |
31536390 |
T |
|
| Q |
103 |
ttcatttcccactttgtccctccgacataccttgttcctaaatccaaacaaagccagccaccatggcaaccaccgcaaccgccgccaccatgtcacattt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536389 |
ttcatttcccactttgtccctccgacataccttgttcctaaatccaaacaaagccagccaccatggcaaccaccgcaaccgccgccaccatgtcacattt |
31536290 |
T |
|
| Q |
203 |
tttcggcacaagtctctgcaaaccaacctcaaacatgggaagagttcgtgctttcttcaacataggtaccaagttaaagccagcacct |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536289 |
tttcggcacaagtctctgcaaaccaacctcaaacatgggaagagttcgtgctttcttcaacataggtaccaagttaaagccagcacct |
31536202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 329 - 460
Target Start/End: Complemental strand, 31536163 - 31536032
Alignment:
| Q |
329 |
tgatgggctagtgtggtttcctggtgctcagccaccggaatggctcgatgggacgatgatcggtgaccgtggttttgatccattgggattagccaaacct |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536163 |
tgatgggctagtgtggtttcctggtgctcagccaccggaatggctcgatgggacgatgatcggtgaccgtggttttgatccattgggattagccaaacct |
31536064 |
T |
|
| Q |
429 |
gttgagtatctgcagtttgatcttgactcact |
460 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31536063 |
gttgagtatctgcagtttgatcttgactcact |
31536032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University