View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_1D_low_15 (Length: 381)
Name: NF9960_1D_low_15
Description: NF9960_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_1D_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 2 - 174
Target Start/End: Original strand, 45152843 - 45153015
Alignment:
| Q |
2 |
caggaggtggtggtgatggaactaaaggtggagggataagtcgtggggggcgtggaaagtaacgaaaggggggtggtgtttgatcaaatggattgtttgg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45152843 |
caggaggtggtggtgatggaactaaaggtggagggataagtcgtggggggcgtggaaagtaacgaaaggggggtggtgtttgatcaaatggattgtttgg |
45152942 |
T |
 |
| Q |
102 |
tgaacggtaagtaggaaaaggccactgtccacaatatccatatagatataggtaaaatgggtcacaccttaag |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45152943 |
tgaacggtaagtaggaaaaggccactgtccacaatatccatatagatataggtaaaatgggtcacaccttaag |
45153015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 247 - 376
Target Start/End: Original strand, 45153088 - 45153217
Alignment:
| Q |
247 |
aggtgtctatgatggttatgagaaagtgttgtactttcagtaagagagtaatgaaagagcaaaacaagggttagtagagctattagtactttgtttgaat |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45153088 |
aggtgtctatgatggttatgagaaagtgttgtactttcagtaagagagtaatgaaagagcaaaacaagggttagtagagctattagtactttgtttgaat |
45153187 |
T |
 |
| Q |
347 |
ccatttcttcgtttcactcatgtggtatgt |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45153188 |
ccatttcttcgtttcactcatgtggtatgt |
45153217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University