View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_1D_low_18 (Length: 356)
Name: NF9960_1D_low_18
Description: NF9960_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_1D_low_18 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 158 - 306
Target Start/End: Complemental strand, 38552099 - 38551951
Alignment:
| Q |
158 |
aatctgaggtggttggaattggatccgaagaagaaagtggattcggatttgggaaaggctatgagcatgtttgagattgatacagccatgttagagtgag |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38552099 |
aatctgaggtggttggaattggatccgaagaagaaagtggattcggatttgggaaaggctatgagcatgtttgagattgatacagccatgttagagtgag |
38552000 |
T |
|
| Q |
258 |
aatggagttggagctagagtatttgtgaattgattaagtgaataaaaaa |
306 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||||||||||||||||| |
|
|
| T |
38551999 |
aatggagttggagctggagtctttgtgaatcgattaagtgaataaaaaa |
38551951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 162 - 261
Target Start/End: Complemental strand, 38545696 - 38545597
Alignment:
| Q |
162 |
tgaggtggttggaattggatccgaagaagaaagtggattcggatttgggaaaggctatgagcatgtttgagattgatacagccatgttagagtgagaatg |
261 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| || || ||||||||| |||||||||| ||||||||||| |
|
|
| T |
38545696 |
tgaggtggttggaattgaatccgaaaaagaaagtggattcggatttgggaaaggctatgaggatcttagagattgatgcagccatgttggagtgagaatg |
38545597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 300 - 356
Target Start/End: Complemental strand, 34860811 - 34860755
Alignment:
| Q |
300 |
taaaaaattctaataattttgtttttattttgatatatgatttggatctttagttat |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34860811 |
taaaaaattctaataattttgtttttattttgatatatgatttggatctttagttat |
34860755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University