View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_1D_low_36 (Length: 251)
Name: NF9960_1D_low_36
Description: NF9960_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_1D_low_36 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 124 - 251
Target Start/End: Original strand, 25175499 - 25175626
Alignment:
| Q |
124 |
atatgcttaccctatcactcaccattattgaannnnnnnccctgaatagaccaagccaataactcagaagataaaacatgaaataaacatgtgattcaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25175499 |
atatgcttaccctatcactcaccattattgaatttttttccctgaatagaccaagccaataactcagaagataaaacatgaaataaacatgtgattcaat |
25175598 |
T |
 |
| Q |
224 |
tctttctttttatttttcatcaattgaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
25175599 |
tctttctttttatttttcatcaattgaa |
25175626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University