View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9960_1D_low_37 (Length: 250)

Name: NF9960_1D_low_37
Description: NF9960_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9960_1D_low_37
NF9960_1D_low_37
[»] chr1 (2 HSPs)
chr1 (1-235)||(7952644-7952878)
chr1 (141-232)||(40388116-40388207)
[»] chr7 (1 HSPs)
chr7 (2-232)||(44162291-44162522)
[»] chr3 (1 HSPs)
chr3 (126-232)||(49454567-49454673)
[»] chr5 (1 HSPs)
chr5 (141-232)||(40084773-40084864)
[»] chr6 (1 HSPs)
chr6 (128-217)||(17776405-17776494)
[»] chr4 (1 HSPs)
chr4 (147-215)||(55351267-55351335)


Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 7952644 - 7952878
Alignment:
1 aggtggtggattatttcacaaatcatgttgcttctctagtggttaataggccaaagttggatggagtcccttttccatctctcactgaggaggagaatga 100  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||    
7952644 aggtggtggattatttcacaaatcatgttgcttctccagtggttaataggccaaagttggatggagtcccttttccatctctcaccgaggaggataatga 7952743  T
101 gtttttgatcgctccattcactttgttggaaatagaggtcgtggttaaagagagtgatggggataaaagcccgggttcggatgggtacaattttgcgttt 200  Q
    ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||| ||||||||||||||||||  ||||||||||||||||||||||    
7952744 gtttttgatcgctccattcactttgttggaaatagaggcggtggttaaagagagtgacggggataaaagcccgggtctggatgggtacaattttgcgttt 7952843  T
201 attaacgaattttggtacttgataaaagatgatgt 235  Q
    |||||  ||||||||||||||||||||||||||||    
7952844 attaagaaattttggtacttgataaaagatgatgt 7952878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 141 - 232
Target Start/End: Complemental strand, 40388207 - 40388116
Alignment:
141 gtggttaaagagagtgatggggataaaagcccgggttcggatgggtacaattttgcgtttattaacgaattttggtacttgataaaagatga 232  Q
    ||||||| ||| ||||||||  ||||||| ||| || ||||||| |  ||||| || ||||| || ||||||||||||||||||||||||||    
40388207 gtggttagagatagtgatggtaataaaagtccgtgtccggatggttttaatttcgcatttatcaaagaattttggtacttgataaaagatga 40388116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 2 - 232
Target Start/End: Original strand, 44162291 - 44162522
Alignment:
2 ggtggtggattatttcacaaatcatgttgcttctctagtggttaataggccaaagttggatggagtcccttttccatctctcactgaggaggagaatgag 101  Q
    |||||||||||||||||  | ||||||| |||||||  ||  | ||||||||||||||||||| || || |||||||||||  | ||||| ||||||  |    
44162291 ggtggtggattatttcatgattcatgtttcttctcttttgtgtgataggccaaagttggatggggtaccgtttccatctctatccgaggatgagaatttg 44162390  T
102 tttttgatcgctccattcactttgttggaaatagaggtcgtggttaaagagagtgatggggataaaagcccgggttcggatgggtacaattttgcgttta 201  Q
      |||||| ||||| ||  | || |||||||||||||  ||||||||||| || ||||||||||||||||||||  ||||||| |  |||||||| ||||    
44162391 cgtttgattgctcctttttccttattggaaatagaggcggtggttaaagatagcgatggggataaaagcccgggaccggatggttttaattttgctttta 44162490  T
202 ttaacga-attttggtacttgataaaagatga 232  Q
    |||| ||  |||||||||||||| ||||||||    
44162491 ttaaggattttttggtacttgattaaagatga 44162522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 126 - 232
Target Start/End: Original strand, 49454567 - 49454673
Alignment:
126 ttggaaatagaggtcgtggttaaagagagtgatggggataaaagcccgggttcggatgggtacaattttgcgtttattaacgaattttggtacttgataa 225  Q
    |||||||| ||||  ||||| | ||| |||||||| | ||||||||||||| ||||||  |  |||||||| |||||||| |||||||||||||||||||    
49454567 ttggaaatggaggcggtggtgagagatagtgatggtggtaaaagcccgggtccggatgcttttaattttgcttttattaaagaattttggtacttgataa 49454666  T
226 aagatga 232  Q
    |||||||    
49454667 aagatga 49454673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 141 - 232
Target Start/End: Original strand, 40084773 - 40084864
Alignment:
141 gtggttaaagagagtgatggggataaaagcccgggttcggatgggtacaattttgcgtttattaacgaattttggtacttgataaaagatga 232  Q
    ||||||| ||||||||||||   ||| ||||||||| ||||||| | ||||||||||||| |||| || |||||||| ||||| ||| ||||    
40084773 gtggttagagagagtgatggtagtaagagcccgggtccggatggtttcaattttgcgtttgttaaggagttttggtatttgatcaaacatga 40084864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 128 - 217
Target Start/End: Original strand, 17776405 - 17776494
Alignment:
128 ggaaatagaggtcgtggttaaagagagtgatggggataaaagcccgggttcggatgggtacaattttgcgtttattaacgaattttggta 217  Q
    |||||||||| | ||||| || |||||||||||| |||| || |||||| ||||||| |  |||||||| ||||||||  ||||||||||    
17776405 ggaaatagagttggtggtgaaggagagtgatgggaataagagtccgggtccggatggttttaattttgcatttattaagcaattttggta 17776494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 215
Target Start/End: Original strand, 55351267 - 55351335
Alignment:
147 aaagagagtgatggggataaaagcccgggttcggatgggtacaattttgcgtttattaacgaattttgg 215  Q
    ||||| ||||||||  |||||||||||||| ||||||| |  |||||||| |||||||| |||||||||    
55351267 aaagatagtgatggtaataaaagcccgggtccggatggatttaattttgcttttattaaagaattttgg 55351335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University