View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_1D_low_39 (Length: 248)
Name: NF9960_1D_low_39
Description: NF9960_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_1D_low_39 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 2912249 - 2912002
Alignment:
| Q |
1 |
aaattaatcgatcacactttttatactaataaaaatgaaatgaaaagtgaagaagaatctttttgcttagatgannnnnnngcagaataataggtgcttg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2912249 |
aaattaattgatcacactttttatactaataaaaatgaaatgaaaagtgaagaagaatctttttgcttagatgatttttttgcagaataataggtgcttg |
2912150 |
T |
|
| Q |
101 |
agagataaaatactaagaagtgggattgaaatgaatgaagattgtgcagtgtagtgtatgctaagagtaacacaaaatgaaataatggctttatgttact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2912149 |
agagataaaatactaagaagtgggattgaaatgaatgaagattgtgcagtgtagtgtatactaatagtaacacaaaatgaaataatggctttatcttact |
2912050 |
T |
|
| Q |
201 |
tataaaacacggtgctacctgctgaaagccctcgaaacaaccggctaa |
248 |
Q |
| |
|
||||||||| ||||||||||| |||||| | ||||||||||||||| |
|
|
| T |
2912049 |
tataaaacatggtgctacctgttgaaagaggtggaaacaaccggctaa |
2912002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University