View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_1D_low_40 (Length: 244)
Name: NF9960_1D_low_40
Description: NF9960_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_1D_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 38815698 - 38815456
Alignment:
| Q |
1 |
aagatgatatcggagtctatcctagatctgttgttggactgcccgcattgtccatgcccctagcccaatttatgccaggttgtgaggcag--tgttggaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
38815698 |
aagatgatatcggagtctatcctagatctgttgttggactgcccgcattgtccatgcccctagtccaatttatgccaggttgtgaggcagggtgttggaa |
38815599 |
T |
|
| Q |
99 |
attttgccttgattgtggtctgcccctagccatcttaaatttggcttttaaatttccttcattgcagcttcgagcaccttaattttgctgggtgtgagag |
198 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38815598 |
attttgccttgattgtggtcttcccctagccatcttaaatttggcttttaaatttccttcattgcagcttcgagcaccttaattttgctgggtgtgagag |
38815499 |
T |
|
| Q |
199 |
gctgggttagtcctacacagcctagagatctaaatagccgtga |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38815498 |
gctgggttagtcctacacagcctagagatctaaatagccgtga |
38815456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 54
Target Start/End: Original strand, 25971190 - 25971227
Alignment:
| Q |
17 |
ctatcctagatctgttgttggactgcccgcattgtcca |
54 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
25971190 |
ctatcctagatctgttgttggacttcccgcatcgtcca |
25971227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University