View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_1D_low_41 (Length: 244)
Name: NF9960_1D_low_41
Description: NF9960_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_1D_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 23 - 83
Target Start/End: Complemental strand, 40200108 - 40200048
Alignment:
| Q |
23 |
agaaattcctactttgaagttgcacccatatggctcatatgtttactccgttaactgtttt |
83 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40200108 |
agaaattcctactttgaagttgcaccgatatggctcatatgtttactccgttaactgtttt |
40200048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 164 - 209
Target Start/End: Complemental strand, 40199966 - 40199921
Alignment:
| Q |
164 |
catacttatttctttggattgttgttagttattcaatttgtgggtg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40199966 |
catacttatttctttggattgttgttagttattcaatttgtgggtg |
40199921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University