View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_1D_low_44 (Length: 237)
Name: NF9960_1D_low_44
Description: NF9960_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_1D_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 231
Target Start/End: Complemental strand, 10976186 - 10975974
Alignment:
| Q |
19 |
ctcaaccaacatcatccactgcagcacaaaccaagaaaaaccaagcaacgatgtaaactcaaatctaaaagcattctcagcagcactagcactctcatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10976186 |
ctcaaccaacatcatccactgcagcacaaaccaagaaaaaccaaccaacgatgtaaactcaaatctaaaagcattctcagcagcactagcactctcatca |
10976087 |
T |
 |
| Q |
119 |
atcctcatctcgtcaccactccccgctgtcgccgacatctccggtctaacaccatgcagagaatcaaaacaattcgccaaacgtgagaaacaatcaatca |
218 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10976086 |
atcctcatctcatcaccactccccgctgtcgccgacatctccggcctaacaccatgcagagaatcaaaacaattcgccaaacgtgagaaacaatcaatca |
10975987 |
T |
 |
| Q |
219 |
aaaagcttgaatc |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10975986 |
aaaagcttgaatc |
10975974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University