View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_1D_low_49 (Length: 230)
Name: NF9960_1D_low_49
Description: NF9960_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_1D_low_49 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 230
Target Start/End: Complemental strand, 32832029 - 32831818
Alignment:
| Q |
19 |
agttttcataagttttggtattttacttggttatgtatcaaattatgctctttcttctcttcctattggtttgaattggagaatcatgcttggtattgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32832029 |
agttttcataagttttggtattttacttggttatgtatcaaattatgctctttcttctcttcctattggtttgaattggagaatcatgcttggtattgct |
32831930 |
T |
 |
| Q |
119 |
gcattacctgcaattcttgttgcacttggtgttttagctatgcctgaatctcctagatggcttgtaatgaaaggtaattttcagtatgactcatactcat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32831929 |
gcattacctgcaattcttgttgcacttggtgttttagctatgcctgaatctcctagatggcttgtaatgaaaggtaattttcagtatgactcatactcat |
32831830 |
T |
 |
| Q |
219 |
agtcggcacaat |
230 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
32831829 |
agtcagcacaat |
32831818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University