View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_2D_high_14 (Length: 293)
Name: NF9960_2D_high_14
Description: NF9960_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_2D_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 52 - 274
Target Start/End: Complemental strand, 39495637 - 39495413
Alignment:
| Q |
52 |
agcatgcatatgactgatatcatcagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaactt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495637 |
agcatgcatatgactgatatcatcagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaactt |
39495538 |
T |
 |
| Q |
152 |
catggtttagtgcttatgatttgtgaatacaggcattgtgtagagtatatt--ggtaagctattatgcagtgttaatagtattagtaactgataattaca |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39495537 |
catggtttagtgcttatgatttgtgaatacaggcattgtgtagagtatattggggtaagctattatgcagtgtgaatagtattagtaactgataattaca |
39495438 |
T |
 |
| Q |
250 |
taagttgttatgttagtcatcgtat |
274 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39495437 |
taagttgttatgttagtcatcgtat |
39495413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 39495705 - 39495767
Alignment:
| Q |
1 |
ggtccccatccaatcaactgcttctcattgtcgaataccatcactttgtctagcatgcatatg |
63 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39495705 |
ggtccccatccaatcaactgcttctcgttgtcgaataccatcactttgtctagcatggatatg |
39495767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 13 - 63
Target Start/End: Original strand, 44373214 - 44373264
Alignment:
| Q |
13 |
atcaactgcttctcattgtcgaataccatcactttgtctagcatgcatatg |
63 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
44373214 |
atcaactgcttctcattgtcaaataccatcactttgtctagcatggatatg |
44373264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University