View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_2D_low_19 (Length: 402)
Name: NF9960_2D_low_19
Description: NF9960_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_2D_low_19 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 1 - 389
Target Start/End: Complemental strand, 13465 - 13077
Alignment:
| Q |
1 |
tcatcattgtaaagggacgaatcagaattgtggagttttaaagaaatatcataaggagtaagagtggattttacagcaagattaccactatcctctaaaa |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13465 |
tcatcattgtaaaggggcgaatcagaattgtggagttttaaagaaatatcataaggagtaagagtggattttacagcaagattaccactatcctctaaaa |
13366 |
T |
 |
| Q |
101 |
gttcaagagtatattttctttgattaagtaaaatgccttgtttgcttctagcaacctcaagacctagaaaatatcgtaaggaaccaaggtctttgatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13365 |
gttcaagagtatattttctttgattaagtaaaatgccttgtttgcttctagcaacctcaagacctagaaaatatcgtaaggaaccaaggtctttgatttt |
13266 |
T |
 |
| Q |
201 |
aaaacgatcattaagaaaacatttaacatgttggatttcagatatatcatttccagctaaaacaatgtcatcaacatatactaacaatgcagtaaatgaa |
300 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13265 |
aaaacgatcaataagaaaacatttaacatgttggatttcagatatatcatttccagctaaaacaatgtcatcaacatatactaacaatgtagtaaatgaa |
13166 |
T |
 |
| Q |
301 |
gaatctttaaattttgtaaaaagggaaaaatcagaagaggattgtagataaccaaaggaaatgagagattcagataacttagaacacca |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13165 |
gaatctttaaattttgtaaaaagggaaaaatcagaagaggattgtagataaccaaaggaaatgagagattcagataacttagaatacca |
13077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University