View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_2D_low_24 (Length: 358)
Name: NF9960_2D_low_24
Description: NF9960_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_2D_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 45076638 - 45076839
Alignment:
| Q |
1 |
ttttatgagacatggcgattgttgtagagaaaccacaagcatatggtcttatatatagagagaggattatatgactacaaaatgcatatcaaaatcaaat |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45076638 |
ttttatgagacatggcaattgttgtagagaaaccacaagcatatggtcttatatatagagagaggattatatgactacaaaatgcatatcaaaatcaaat |
45076737 |
T |
|
| Q |
101 |
caaaagttattattatttggctatacaatttttcctatggttaatgttgattcattgtaaagagaaaagtaataaaggtaattcaattttttactttatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45076738 |
caaaagttattattatttggctatacaatttttcctatggttaattttgattcattgtaaagagaaaagtaataaaggtaattcaattttttactttatg |
45076837 |
T |
|
| Q |
201 |
cc |
202 |
Q |
| |
|
|| |
|
|
| T |
45076838 |
cc |
45076839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 302 - 347
Target Start/End: Original strand, 45076940 - 45076985
Alignment:
| Q |
302 |
gaagaaaattttattgaaatactaacaagtatttagatgtccatct |
347 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45076940 |
gaagaaagttttattgaaatactaacaagtatttaaatgtccatct |
45076985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University