View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9960_2D_low_31 (Length: 293)

Name: NF9960_2D_low_31
Description: NF9960_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9960_2D_low_31
NF9960_2D_low_31
[»] chr8 (2 HSPs)
chr8 (52-274)||(39495413-39495637)
chr8 (1-63)||(39495705-39495767)
[»] chr3 (1 HSPs)
chr3 (13-63)||(44373214-44373264)


Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 52 - 274
Target Start/End: Complemental strand, 39495637 - 39495413
Alignment:
52 agcatgcatatgactgatatcatcagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaactt 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39495637 agcatgcatatgactgatatcatcagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaactt 39495538  T
152 catggtttagtgcttatgatttgtgaatacaggcattgtgtagagtatatt--ggtaagctattatgcagtgttaatagtattagtaactgataattaca 249  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||| ||||||||||||||||||||||||||    
39495537 catggtttagtgcttatgatttgtgaatacaggcattgtgtagagtatattggggtaagctattatgcagtgtgaatagtattagtaactgataattaca 39495438  T
250 taagttgttatgttagtcatcgtat 274  Q
    |||||||||||||||||||||||||    
39495437 taagttgttatgttagtcatcgtat 39495413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 39495705 - 39495767
Alignment:
1 ggtccccatccaatcaactgcttctcattgtcgaataccatcactttgtctagcatgcatatg 63  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||    
39495705 ggtccccatccaatcaactgcttctcgttgtcgaataccatcactttgtctagcatggatatg 39495767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 13 - 63
Target Start/End: Original strand, 44373214 - 44373264
Alignment:
13 atcaactgcttctcattgtcgaataccatcactttgtctagcatgcatatg 63  Q
    |||||||||||||||||||| |||||||||||||||||||||||| |||||    
44373214 atcaactgcttctcattgtcaaataccatcactttgtctagcatggatatg 44373264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University