View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_2D_low_33 (Length: 244)
Name: NF9960_2D_low_33
Description: NF9960_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_2D_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 19 - 106
Target Start/End: Complemental strand, 30671606 - 30671519
Alignment:
| Q |
19 |
agttgaatatcttgagcaacttttaactatgtcagatcatcaaagtacaagcaccagctacttctgagaaaacttgttaatttcagta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30671606 |
agttgaatatcttgagcaacttttaactatgtcagatcatcaaagtacaagcaccagctacttctgagaaaacttgttaatttcagta |
30671519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 183 - 244
Target Start/End: Complemental strand, 30671442 - 30671381
Alignment:
| Q |
183 |
cattctcttcttattacttttcagaagaaacaaaatttattcatattttgagttcaaagagt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30671442 |
cattctcttcttattacttttcagaagaaacaaaatttattcatattttgagttcaaagagt |
30671381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 30710261 - 30710210
Alignment:
| Q |
19 |
agttgaatatcttgagcaacttttaactatgtcagatcatcaaagtacaagc |
70 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
30710261 |
agttgaatatcttgagcaacttctaagtatgtcagataatcaaagtacaagc |
30710210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 30656445 - 30656393
Alignment:
| Q |
19 |
agttgaatatcttgagcaacttttaactatgtcagatcatcaaagtacaagca |
71 |
Q |
| |
|
|||||||||||||||||||||| |||| || || ||| |||||| |||||||| |
|
|
| T |
30656445 |
agttgaatatcttgagcaacttctaaccatatctgataatcaaactacaagca |
30656393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 30689504 - 30689452
Alignment:
| Q |
19 |
agttgaatatcttgagcaacttttaactatgtcagatcatcaaagtacaagca |
71 |
Q |
| |
|
|||||||||||||||||||||| || | || || ||| ||||||||||||||| |
|
|
| T |
30689504 |
agttgaatatcttgagcaacttctatccatatctgataatcaaagtacaagca |
30689452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University