View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_2D_low_36 (Length: 225)
Name: NF9960_2D_low_36
Description: NF9960_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_2D_low_36 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 14115 - 13946
Alignment:
| Q |
18 |
caagcttggatatgaaagtaaggaacgagggactgtgtaaaggttttgtaagtacgtcggctgtttgcgcggcagaaggtatgggaaatagtcgcagcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14115 |
caagcttggatatgaaagtaaggaacgagggactgtgtaaaggttttgtaagtacgtcggctgtttgcgcagcagaaggtatgggaaatagtcgcagcag |
14016 |
T |
 |
| Q |
118 |
gccattttgaatcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14015 |
accattttgaatcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactg |
13946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 181
Target Start/End: Original strand, 43010780 - 43010827
Alignment:
| Q |
134 |
tctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatgg |
181 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
43010780 |
tctctgatgatgtgacaatctatttcaacgtgtttaatacgttcatgg |
43010827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 216
Target Start/End: Original strand, 18155087 - 18155116
Alignment:
| Q |
187 |
gtatatcaatattcagtcttcggttcatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
18155087 |
gtatatcaatattcagtcttcggttcatat |
18155116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University