View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_low_11 (Length: 261)
Name: NF9960_low_11
Description: NF9960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 36946494 - 36946329
Alignment:
| Q |
1 |
aatcccatttggaaattgaacgtttctcacaagaacagtggtttccttggtggcagaattgtatttcaaaacccttccactattatcaccggaaagtatc |
100 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
36946494 |
aatcccatttggaaattgaatgtttctaacaagaacggtggtttccttggtggcagaattgtatttcaaaaccctcccactattgtcaccagaaagtatc |
36946395 |
T |
 |
| Q |
101 |
agctgaatgaaattcctgcatgtagaatgacatcagaagtcaacatcaa-caaaccagccaaactt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||| |
|
|
| T |
36946394 |
agctgaatgaaattcctgcatgtagaatgacatcagaagtcagcaccaataaaaccagccaaactt |
36946329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 5 - 118
Target Start/End: Original strand, 17768281 - 17768394
Alignment:
| Q |
5 |
ccatttggaaattgaacgtttctcacaagaacagtggtttccttggtggcagaattgtatttcaaaacccttccactattatcaccggaaagtatcagct |
104 |
Q |
| |
|
|||||||| |||||||| || ||||| ||||||||||||||||| || |||| ||||||||||||||| ||||||||| ||| ||||||| || ||||| |
|
|
| T |
17768281 |
ccatttgggaattgaacattcctcactagaacagtggtttcctttgttgcagggttgtatttcaaaacctttccactatcatccccggaaaataccagct |
17768380 |
T |
 |
| Q |
105 |
gaatgaaattcctg |
118 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
17768381 |
gcatgaaattcctg |
17768394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University