View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9960_low_5 (Length: 340)
Name: NF9960_low_5
Description: NF9960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9960_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 195 - 324
Target Start/End: Original strand, 45153088 - 45153217
Alignment:
| Q |
195 |
aggtgtctatgatggttatgagaaagtgttgtactttcagtaagagagtaatgaaagagcaaaacaagggttagtagagctattagtactttgtttgaat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45153088 |
aggtgtctatgatggttatgagaaagtgttgtactttcagtaagagagtaatgaaagagcaaaacaagggttagtagagctattagtactttgtttgaat |
45153187 |
T |
|
| Q |
295 |
ccatttcttcgtttcactcatgtggtatgt |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45153188 |
ccatttcttcgtttcactcatgtggtatgt |
45153217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 16 - 122
Target Start/End: Original strand, 45152909 - 45153015
Alignment:
| Q |
16 |
aggggggtggtgtttgatcaaatggattgtttggtgaacggtaagtaggaaaaggccactgtccacaatatccatatagatataggtaaaatgggtcaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45152909 |
aggggggtggtgtttgatcaaatggattgtttggtgaacggtaagtaggaaaaggccactgtccacaatatccatatagatataggtaaaatgggtcaca |
45153008 |
T |
|
| Q |
116 |
ccttaag |
122 |
Q |
| |
|
||||||| |
|
|
| T |
45153009 |
ccttaag |
45153015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University