View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9961_high_27 (Length: 257)
Name: NF9961_high_27
Description: NF9961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9961_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 20875272 - 20875045
Alignment:
| Q |
18 |
acatgtactttggaacgaaaagagtactattatagacagaaagaggcgtgatgtagaaacgacacataaactaattagatgcatgtatgctgaaactaag |
117 |
Q |
| |
|
||||||| ||||||||||| | ||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||||| |
|
|
| T |
20875272 |
acatgtattttggaacgaatatagtactattttagacggaaagaggcgtgatgtagaaacgacacatcaactaattagatgcatgtatgttgacactaag |
20875173 |
T |
 |
| Q |
118 |
ctaagaagtacacatattgttgtcttggggagcgtttaagcttgcttcttctccagagttttcttggtcatcaatatgtcatgtccttaatagaaccgat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20875172 |
ctaagaagtacacatattgttgtcttggggagcgtttaagcttgcttcttctccagagttttcttggtcatcaatatgtcatgtccttaatagaaccgat |
20875073 |
T |
 |
| Q |
218 |
cttattctcgaaatttcgtacttttctc |
245 |
Q |
| |
|
||||||||||||||||| |||||||||| |
|
|
| T |
20875072 |
cttattctcgaaatttcatacttttctc |
20875045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 170
Target Start/End: Complemental strand, 15191307 - 15191271
Alignment:
| Q |
134 |
ttgttgtcttggggagcgtttaagcttgcttcttctc |
170 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |
|
|
| T |
15191307 |
ttgttgtcttggggagccttgaagcttgcttcttctc |
15191271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University