View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9961_high_55 (Length: 202)
Name: NF9961_high_55
Description: NF9961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9961_high_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 16 - 153
Target Start/End: Complemental strand, 49766229 - 49766092
Alignment:
| Q |
16 |
caaagggagtagttgctaattctaatggtattgcttctgtgaaccgtgctcaagaccaccaccaccatcaccatcattgcatgaaagagagagtacttag |
115 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766229 |
caaagggagtagttgctagttctaatggtattgcttctgtgaaccgtgctcaagaccaccaccaccatcaccatcattgcatgaaagagagagtacttag |
49766130 |
T |
 |
| Q |
116 |
aaggtgtggaggaatattcagtggtttcatgatgacat |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766129 |
aaggtgtggaggaatattcagtggtttcatgatgacat |
49766092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University