View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9961_low_38 (Length: 251)
Name: NF9961_low_38
Description: NF9961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9961_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 16 - 241
Target Start/End: Complemental strand, 56471284 - 56471059
Alignment:
| Q |
16 |
ctatattggctccacctactctctttgtaaaggttagtttattagttaattaactactcggtgcaatattatatgtgggggtctgtgtcatccctattac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56471284 |
ctatattggctccacctactctctttgtaaaggttagtttattagttaattaactactcggtgcaatattatatgtgggggtctgtgtcatccctattac |
56471185 |
T |
|
| Q |
116 |
aaatgcatatccttaaatgacatttattatagtttttaacgtggaaaaatggcttgagtttttcagatttttggctcaattttcggggttgcagctggtt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56471184 |
aaatgcatatccttaaatgacatttattatagtttttaatgtggaaaaatggcttgagtttttcagatttttggctcaattttcggggttgcagctggtt |
56471085 |
T |
|
| Q |
216 |
ttgttgtgggtaaggaaggacctatg |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
56471084 |
ttgttgtgggtaaggaaggacctatg |
56471059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University